Scientist Has Discovered Human Gene Cancer Cells Nucleotide Sequence Template Strand Gene

a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene was determined as written below: 3’gacacgtacgagcctggacaccttaagagcgggctcggaacactggccccgattgacac5′ (a) study the nucleotide sequence of the template strand and write sense strand (showing direction) of the gene. (b) write down the mrna produces from this gene. (c) how many amino acids will be present in the protein product of this gene. (d) write amino acid sequence of the polypeptide

Answer

Study Cred Tutor

4.6 (24k+)
4.6/5

Purchase the answer to view it

×

Hello!

Click one of our contacts below to chat on WhatsApp

× How can I help you?